PEG-PLGA Polymersomes Encapsulate and Deliver CRISPR-Cas9 Ribonucleoprotein to Elicit Gene Knockout in HEK-293 GFP Cells

Saturday, October 11, 2025

9:05 AM - 9:10 AM PDT

Location: Room 29B

Presenting Author(s)

Ava McKee

Undergraduate Student at Clemson University
Clemson University
Waxhaw, North Carolina, United States

Co-Author(s)

QM

Quintin Martin

Undergraduate Student at Clemson University
Clemson University, United States

Last Author(s)

Jessica Larsen

Associate Professor
Clemson University, South Carolina, United States

Primary Investigator(s)

Jessica Larsen

Associate Professor
Clemson University, South Carolina, United States

Introduction: : Genetic diseases represent an extreme global burden, yet current treatments are limited to addressing patients’ symptoms rather than treating the cause. With advancements in gene editing technologies, such as gene therapy vectors and non-viral methods, scientists are closer to developing curative treatments. A particularly promising approach is the use of clustered regularly interspersed short palindromic repeats-associated protein 9 (CRISPR-Cas9), a precise gene editing tool that targets specific DNA sequences. To overcome the limitations of delivering CRISPR-Cas9, we investigate the use of self-assembling polymer-based nanoparticles (polymersomes) as an effective encapsulation method and delivery system for the Cas9 ribonucleoprotein (RNP), allowing for non-viral gene-editing across the blood-brain barrier (BBB).

Materials and

Methods: : Polyethylene glycol-b-polylactic-co-glycolic acid (PEG-PLGA) polymersomes were synthesized via film rehydration followed by filtration, then characterized using transmission electron microscopy (TEM) to confirm morphology and dynamic light scattering (DLS) to determine nanoparticle size, polydispersity index (PDI), and zeta-potential. During the self-assembly process, Cas9 protein was encapsulated by polymersomes while the mixture spun for 18-24 hours at 4°C to maintain protein stability. To assess RNP complexation and qualitatively evaluate encapsulation efficiency, gel electrophoresis was performed to detect free versus bound Cas9. Additionally, a bicinchoninic acid (BCA) assay was used to quantify the amount of Cas9 protein encapsulated within the polymersomes.
Human embryonic kidney cell line, HEK-293-GFP, contains a green fluorescent protein (GFP) that is targeted by the single guide RNA (sgRNA) sequence, which is 5′-CCAUGGCACG GGCAGCUUGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′. Electroporation was performed to measure the effectiveness of the Cas9 RNP complex independently, in increasing concentrations, to knock out the GFP gene irrespective of delivery barriers. The addition of TAT, a positive charge, to polymersomes was tested to enhance endocytosis and lysosomal escape. A cell study was also performed to measure the ability of polymersome-encapsulated Cas9 RNP to induce knockout of the GFP gene. Similarly to the electroporation study, treatments containing TAT and varying concentrations of Cas9 RNP were tested. To measure the cell viability and polymersome toxicity, an MTS was performed. Gene editing was measured using fluorescence microscopy and quantified using flow cytometry in both electroporation and knockout studies.

Results, Conclusions, and Discussions:: The DLS results demonstrated that all polymersomes had an average size of 84.35nm ± 9.63nm with an average PDI of 0.19 ± 0.03, indicating uniform nanoparticles. TEM confirmed successful self-assembly into the desired spherical morphology. Gel electrophoresis confirmed that polymersomes were capable of encapsulating Cas9 RNP at 30nM, 40nM, and 50nM concentrations with no unencapsulated Cas9. The BCA assay revealed an average encapsulation efficiency of 5μg ± 1μg Cas9. As shown in Figure 1, electroporation of Cas9 RNP resulted in 64% GFP knockout in HEK-293 cells after 72 hours, confirming the effectiveness of Cas9 RNP to elicit gene knockout independently of using polymersomes for transport. In another experiment using polymersomes for delivery, TAT polymersomes containing 30nM, 40nM, and 50nM Cas9 RNP induced effective GFP knockout, which was confirmed by microscopy (Figure 2) and flow cytometry. Notably, 50nM Cas9 RNP without TAT also showed strong visual knockout, suggesting that while TAT enhances intracellular delivery and may promote endosomal escape, higher RNP concentrations can achieve editing without it. All tested polymersomes were nontoxic to HEK293-GFP cells at 30nM, 40nM, and 50nM concentrations.

Acknowledgements and/or References (Optional): : Work was supported by NIH Center for Biomedical Excellence (COBRE) P20GM139769